Lab Report templar 2017 Compatibility Madal insert Draw Design Layout References Malings Review vew Q me what you war to da Cambria (sodn 12 A A Aa. MalibceD AaBbcu Arabcct AaB No spa Heading 5. You wish to clone an insert nsert “x) by PCR-cloning, into the psK+ vector. The start and stop codons for the open reading frame bp) you want to as insert indicated by a green circle and a stop sign, respectively. Below is a restriction map for the region, the sites for the indicated restriction enzymes: Hindlll Xhol Spel Xbal. approx.. 100 bp No restriction sites: AlwNl, Sall, EcoRI, BstXI, Notl, BamHI. You wish to clone the whole open reading frame using a site present within the multiple cloning site of pSK CAGTGAAT TGTAATACGACTCACTATAGGGCGAATTGGGTAccGGGcccccccTOGAGGTCGACGGT TTGT 3-20 Primer binding ATCGATA GCTTGATATCGAATTCCTGCAGCCCGGGGGATCCAC TAGTTCTAGAGOGG CCGCCACCGCGGTG GAGCTCCA O Type here to search